Skip to main content

Imagine being a parent& knowing the answer existsbut no one can give it to you.

For 13 years,

Rena lived inside

that gap.

Tests were run. Data was generated. Sequencing was done.
The science was there.
What wasn't there was interpretation.
No system could move fast enough.
No workflow could connect the dots at scale.
So a child waited while answers sat buried in data.
She's 14 now.
That year mattered.

This is the part of healthcare most people never see.

Genomics didn't fail Rena.

Interpretation did.

Today, millions of genomes are sequenced every year. Labs are drowning in variants. Variant scientists are exhausted.

Manual curation is slow, inconsistent, and impossible to scale.

The result isn't abstract.

It's delayed diagnoses.

It's families waiting.

It's lives paused in uncertainty.

That's why we built

GeneGenius.

Not another “healthcare AI.”

Not another dashboard.

We're building an interpretation engine

the missing layer between raw genomic data and real clinical decisions.

A system that:

Reads and reasons through variants at machine scale

Applies clinically aligned logic consistently

Surfaces evidence transparently and audibly

Keeps humans in control, but no longer buried

ACGTAGTCAGCTAGTCAGTC

So far, this isn't a vision
it's happening.

We've built working systems.

We've benchmarked against thousands of expert-curated variants.

We've proven the economics make sense.

We've shown interpretation doesn't have to take weeks or months.

This is what it looks like when genomics finally moves at the speed patients need.

A clinician opens a case.

Instead of a wall of uncertainty, they see structured evidence.

Clear reasoning.
Transparent logic.

Confidence
not
guesswork.

That's the future we're building.

COO of GeneGenius

Faraz

COO & Co-Founder at GeneGenius

This isn't optional. Millions of genomes are being sequenced. Interpretation is the bottleneck. We're building an AI interpretation engine that turns raw variants into fast, consistent, auditable clinical decisions.

If this story stays with you

If you believe interpretation should never be the reason a child waits

If you want to help build something that becomes infrastructure, not noise